![]() The missions are shorter and more action-packed than before, breaking a campaign up into six or so fifteen-minute missions. It's fun right from the outset, and gives you well enough time to learn the ropes and various strengths of the unit types before dropping you into bigger, more complicated battles. It's easy to get used to, and the game gives you two or three gentle missions as the start to ease you into things. You move with the Nunchuk and aim with the remote, with a lock-on button to ease the process, and commanding units one at a time or in groups is all done with the d-pad. Mercifully, the Wii controls work perfectly, which contributes significantly to BWii's improvements over the original. No, Recon vehicle! Stay back! You'll never survive the bazookas! It's all about finding the balance on the battlefield between commanding your units and taking control of them directly. It's a third-person blaster that lets you jump into the shoes of any of your units at the press of a button, leading the platoon with an assault veteran before switching to an anti-air unit to personally take care of an incoming bomber. Like its GameCube predecessor, BWii is very loosely based on Advance Wars - its mission structure, grading system and unit types closely mimic those of Intelligent Systems' handheld cartoon war-game, but it plays completely differently. BWii definitely has a sense of humour, and though it's mostly light-hearted it does tinge proceedings with a touch of satire on occasion. The evil empires have an accent that's a strange mix of Russian and German. The Solar Empire's General A'Quira is voiced by a loud, high-pitched man who mixes up his 'l's and 'r's, the Western Frontier's Sarge Herman by a chap who manages to sound as thick-necked as his buzz-cut-sporting on-screen representation looks. Still, it does at least turn out that they do have a pretty powerful satellite weapon hidden away, but they didn't know about it - someone threw it off a cliff several years previously. 'The Anglo Isles: "This green and pleasant island nation once commanded a mighty empire, but is now relegated to the backwaters of global diplomacy." Battalion Wars 2 begins as Colonel Windsor launches an Anglican attack on Japa - sorry, the Solar Empire, having heard rumours from some mysterious source that their army has been developing a weapon of mass destruction. None of Battalion Wars 2's feuding nations is free from its pokey stick of satire, not even our own. Remember the self-referential, idiosyncratic humour and gentle racial stereotyping that used to characterise British games? Kuju has done us proud with BWii.
0 Comments
There is a button in the header part of the APE to reverse complement the. To reverse complement, copy the sequence (ctrl+c or cmd+c) and past the sequence (ctrl+v or cmd+v) in new window (Fig 4.1). In C++ it's better to return a value from a function than to manipulate a variable via pointer. As the template sequence is from 5’ to 3’ direction, the reverse primer cannot be ordered directly.Std::cout << "Reverse Compliment: " << std::endl << seq << std::endl Std::cout << "DNA sequence: " << std::endl << seq << std::endl ![]() Std::string seq("TGAGACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTG") Std::transform(seq.cbegin(), seq.cend(), seq.begin(), lambda) Throw std::domain_error("Invalid nucleotide.") The following code is C++11 (do you have C++11 compiler?) written as I would do it. If you don't like pointers, please, don't use them! In modern C++ pointers aren't often necessary. I've been programming in Java for over a year now so I've gotten really rusty with pointers in C++, I'm guessing the problem lies in the reverse methods and the way to pointers are shifted around through each pass of the function call #includeĬhar s = Ĭout << "DNA sequence: "<< endl << s << endl Ĭout << "Reverse Compliment: "<< endl << s << endl Ĭhange the reverse method like this void reverse(char s) The complements for each letter in the sequence are However my output didn't work as expected. Note having palindromic sequences along short the short stretches over which restriction enzymes function is not common.So I am trying to create the complement of the sequence Having short stretches of DNA that read the same on both strands of double-stranded DNA allow restriction enzymes to cut both strands in the same place. Calculate the reverse complement of the whole forward strand to finish the reverse strand: ATCGAT.Reverse the order of the reverse complement ( CTA) and add it to the end of the forward strand - TAGCTA.Calculate the reverse complement of the sequence - ATC.Starting with the original sequence - TAG.TAGCTA) can be reconstructed from just knowing the first three bases on one strand: For example, a six-base recognition sequence (e.g. This pattern makes it possible to reconstruct a palindromic sequence from one-half of one strand. Calculate the physical properties like GC content, Tm and extinction coefficient of your oligo sequence as well as reverse and complement sequences. The complement to the whole six base strand is CCTAGG, read backwards (as it would be when reading from 5’ to 3’ on the complementary strand) is GGATCC, an exact match for the original strand. Note the first three bases GGA are followed by the complement of those three bases in reverse order: TCC. ![]() For example the recognition sequence for BamHI is GGATCC. Palindromic sequences are a short run of bases (typically 3 to 5 in length), follow by their complementary bases in reverse order. They are probably more properly referred to as palindromic sequences to distinguish them from language palindromes. In English, the term palindrome refers to a string of letters that have the same meaning written in both directions some classic English palindrome are kayak, civic, noon, and racecar.Īs a set of paired sequences (one on each of the strands of a double strand of DNA), the palindromes recognized by restriction enzymes follow a slightly different set of rules. (This may just be a mistranslation but in the manga her name is spelled Grelle and I saw something somewhere saying she changed it to make it more feminine. Indeed, users sometimes pair face blowing a kiss emoji with the OK hand emoji to imitate the gesture. She speaks about wanting a womb and how she’s an actress. The emoji can also express enthusiastic appreciation, much like the “Italian chef kiss” trope indicating something is perfect. ![]() Very honored to be included in Best of 2017: Crime Reporting !! Throwing a kiss, in real life and in emoji form, can also signal gratitude: “Thank you! Thank you!” May represent a kiss goodbye or good night and convey feelings of love and affection more generally. The emoji can be more flirtatious, playful, and complimentary, too, as if to say “You look Killing with her Hottest, Cutest & Stylish Looks at the GQ Best Dressed 2017 #Slaying □□□ #FlashBackVideo □ /txTK7E4rUz A yellow face winking with puckered lips blowing a kiss, depicted as a small. We will see that you have prepared us 2018 □□❤ /HuOxS9ZHcZĬhocolate lovers like…. Install the Grell - Black Butler sticker pack for Telegram This is a set of 32 static stickers. Without a doubt the best thing of 2017 was to be next to this beautiful person, thanks for being part of my life. The emoji is also generally friendly, but it is mean to be a flirty kiss too. Remember that cheek kissing is a common greeting and parting in many cultures, especially in Europe, so the emoji isn’t just reserved for romantic love. Install the Grell - Black Butler sticker pack for Telegram This is a set of 32 static stickers. Kiss emoji is used mostly as an affectionate way to say goodbye. ![]() The object of the emoji’s affection can be, as the above text-grab shows, loved ones, but also family, friends, pets, our favorite things-even public figures. The face blowing a kiss emoji sees extensive use in text and instant messages to give a digital “kiss goodbye” or “kiss goodnight.” ![]() Erik Fisher from Beyond the To Do I’m thankful for all the people who are learning in the journey of productivity and creativity with my show.ĭan I'm thankful for the podcasting community that is coaching me in getting into it as a hobby. Mike Dell from Geek of the I'm thankful I get to work with such a great company in Podcasting ( and all the friends I've made #podcasting Professor Alan from Book Guys I'm thankful for being able to talk regularly with fellow book lovers and authors. Disqus commenting system plugin (plus Akismet) for moderating website comments.Akismet WordPress plugin for blocking spam.Matthew Lowell from The Awaken Revolution: People who believe podcasting is its own medium.Podcasters who share their passions to change the world.Internet in general and what it has enabled.Jeremiah Miller from Chunks o' Wisdom: I'm thankful for the Audacity to Podcast, and all of your help!Īnne-Sophie from Your Life Your community SgtFred: Sorry, I meant to say: “I am THANKFUL for Lon Naylor (i.e., “Mr. Camtasia”) and his giving to the video, elearning and tutorial community. Richard from Naked Ape Productions: Wirecast for professional live-streaming video. I'm thankful for the global reach that podcasting has and that with it there are no geographical boundaries. My personal podcast where I share my testimony has been downloaded in over 40 different countries, including many in the middle east, which would not be possible without the global reach of podcasting.ĭJ City from The Japan Experience Podcast: we can broadcast our voices across the Internet and reach others with our interests.Īs a listener, the thing I am most thankful for in podcasting is the vast diversity of podcasts to fill my day with. I can, pretty much, find a podcast (or two) covering any given topic I may want to learn more about and it's awesome to have that kind of instant gratification when I used to have to wait for my favorite radio shows to come on the airwaves at their scheduled times.Īs a podcaster, I am most thankful for the community of podcast producers. Thanks for all you do and, specifically, for the great work with TAP! What I'm thankful for In fact, I am launching my own podcast network in January with 4 unique shows initially that already have 3-4 shows recorded each! I would never have thought to even try and produce my own podcasts but shows like TAP and Cliff Ravenscraft's Podcast Answer Man, have taught me so much and equipped me to be confident that I can be a successful podcast producer as well. And check out the X-keys controller for Wirecast Mac or Windows. Podcast listeners who have supported my business by hiring me or referring others to me. Use Elgato Stream Deck with Wirecast with our new plugin.Canon T4i digital SLR camera for still photos and HD video.My new iPhone 5, which doubles as my new iPod.The camaraderie among other podcasters instead of competition. ![]() I will try switching from Audacity to Audition for a couple weeks. ![]()
![]() What you won't find in the Transit Trail is an Instagram-worthy living space Ford leaves that sort of customization up to you or the upfitter of your choice. ![]() For 2023, a camper-prepped version called the Transit Trail is also offered and comes with more rugged styling and interior features that befit an adventure van, such as swiveling front seats, an onboard AC inverter, and a built-in fuse panel. The van's cabin design is slick and contemporary, taking cues from the Ford Explorer, and it’s quiet inside at highway speeds. ![]() The Transit passenger wagon seats up to 15. Interior, Comfort, and Cargoįord offers the Transit with a variety of roof heights and wheelbase lengths, which allows you to tailor the cabin size to fit your needs. For more information about the Transit's fuel economy, visit the EPA's website. On our 75-mph highway fuel-economy route, which is part of our extensive testing regimen, the Transit with the turbocharged V-6 logged 17 mpg. As is the case with many full-size vans, the Transit isn't exactly a leader in fuel efficiency. As a result, this van hasn't been tested by the EPA. Tested: Ford Transit 350 Outpaces Its Rivalsįull-size vans such as the Transit are exempt from federal fuel-economy standards.2023 Ford Transit Trail Is Camp Version of the Van.The Transit's suspension is tuned to deliver a forgiving ride quality that you'll appreciate during daily commutes. A Transit with the turbocharged V-6 that we tested made it to 60 mph in 6.8 seconds. The Mercedes Sprinter offers more robust payload capabilities. Both engines are paired with a 10-speed automatic transmission, and buyers can choose between rear-wheel drive and all-wheel drive. There's also a turbocharged 3.5-liter V-6 available that generates 310 horsepower and 410 pound-feet of torque. The base engine is a naturally aspirated 3.5-liter V-6 that provides 275 horsepower and 262 pound-feet of torque. Engine, Transmission, and Performanceįord's Transit is offered with two powertrains. We'd include the optional blind-spot monitoring for safer lane changes. Additionally, all Ford Transit vans come with driver-assistance features such as lane-keeping assistance and lane-departure warning. The list of standard equipment includes amenities such as Bluetooth connectivity, dual USB ports, and air conditioning. A four-way adjustable driver's seat and a manually adjustable tilt-and-telescoping steering column are on hand to help you get comfy behind the wheel. This van rides on 16-inch steel wheels and comes with exterior features such as power-adjustable sideview mirrors and a split swing-out rear door for easy cargo access. The base-model Ford Transit cargo van T-150 that comes with a generous selection of standard features is our pick of the range. Ford's fleet management-and- telematics system is the tech that's likely more interesting to fleet buyers, as it allows for better tracking and data analysis of their armada of vans. Technology plays a role here too: all Transit models come standard with basic driver-assistance features, and Ford's Sync 4 infotainment system is available with a large 12.0-inch display screen. The Transit's main rivals include the Mercedes-Benz Sprinter and the Ram ProMaster, but the Ford feels more maneuverable than either of them. Starting this year, Ford will also sell a specially-equipped model that's a perfect base for a camper-van conversion-how's that for versatility, overlanders? Two gasoline-powered engines are on offer-a naturally aspirated V-6 and a turbocharged Ecoboost V-6-and buyers can choose from rear- or all-wheel drive. It can be ordered in a variety of body styles, including a cavernous high-roof extended version that has room to haul a plethora of tools, packages, or cargo. But for millions of small business owners and fleet managers, it's extremely relevant and particularly desirable. For most drivers, a commercial van such as the 2023 Ford Transit isn't on their radar. ![]() But if the craving hits for a classic, we've got slider-friendly recipes to please. Same with sandwiches-if you're serving a large group, it's not always easy to prepare sandwich after sandwich. Our shredded chicken Parm sliders, chicken & waffles sliders, and chicken enchilada sliders turn crowd-pleasing meals into shareable appetizers for an entire crowd. If you're craving a classic dish but need a shareable version, we've got you. Looking to stay safe? Our ham & cheese sliders and Hawaiian roll sliders never fail to be party favorites. ![]() While we've got classic flavors here, we've also got plenty of creative variations. No matter the game's result, you can rest assured-these sliders score every time. If you're looking for a hearty addition to your Super Bowl appetizer spread, prep one of these sliders to keep your whole party pumped up to cheer on all day long. ![]() These shareable mini sandwiches are not only filling, versatile, and flavorful, but are incredibly quick and easy to whip up for your whole team. "That's where our paths will diverge I think my husband and I are too tired for that.Looking for the easiest, no-stress way to serve a crowd this game day? Sliders are the way to go. "But what they have achieved is amazing, and the sky's the limit for them."Īlthough Drummond is happy for the Gaineses and their new TV network, she has no such aspirations. "I do see many similarities, and Joanna and I have exchanged an email or two cheering each other on," she says. "I've kind of taken some of those concepts and tried to consider the amount of sugar and flour I'm eating on any given day. … They're not earth-shattering or groundbreaking, but for me they're a little bit of a shift."ĭrummond incorporated that into her sixth cookbook, "The New Frontier," due in October, which features less decadent versions of some of her recipes but is "by no means going to be a diet or healthy cookbook."ĭespite her burgeoning business empire, Drummond laughs off comparisons to "Fixer Upper" couple Chip and Joanna Gaines, who live in Waco, Texas. "I did a little playing with keto last summer," Drummond says. She recently traded in some of her comfort staples for one of the current food crazes: the keto diet, which promotes eating low-carb, high-fat foods. "I'm just a home cook, and that probably makes it a level of accessible to a lot of people." ![]() "Some people come just for the recipes, and others come because they like the ranch, but I think probably overall I'm not and I've never presented myself as an expert," Drummond says. You don't have to have culinary school to be a good cook." EDT/PDT), has "helped a lot of people relax in the kitchen. Her Food Network show, "The Pioneer Woman" (Saturdays, 10 a.m. Known for her down-home country-comfort cooking (comfort meatballs and creamy mashed potatoes) and quick family meal recipes, Drummond has won fans who love her lifestyle as much as they love what she's serving them. Her writing on The Pioneer Woman led to the first of five cookbooks, "The Pioneer Woman Cooks: Recipes from an Accidental Country Girl," and a TV show that catapulted her to fame. The nickname stuck, and became the title of her blog about life as a ranch wife and mother. When she told her high school friends "I was marrying a rancher and moving to the country, they were like 'What?' And they started calling me Pioneer Woman as a joke," Drummond says. More: 'Pioneer Woman' Ree Drummond answers our questionsĭrummond, 50, sealed her fate in smalltown Oklahoma when she met her husband, Ladd, and became pregnant with her first child soon after marrying him and moving to his ranch. Yet I'm still at home on the ranch, and I'm able to do these things that I'm passionate about." "It's not something that I could have possibly conceived of or orchestrated," she told USA TODAY about her growing empire. "I think that's part of why it's been so much fun, because it wasn't ever a direction I thought my life would head. The Oklahoma mom of four hopes to spend time with her kids – and take a monthlong breather from her Pioneer Woman alter ego that sparked a blog, cookbooks, a popular Food Network cooking show, restaurants, a Hearst magazine, a cookware line, children's books and now, a line of dog treats.Īnd yet, for all the irons Drummond has in the fire, she seems pretty calm about it on a sunny day in New York's Bryant Park, where she gets to play with puppies and greet fans to promote her Purina collaboration (she'll get that break soon enough). NEW YORK – Summer break is getting closer, and it's a welcome time off for Ree Drummond. Watch Video: Pioneer Woman Ree Drummond talks food, puppies ![]() Your OSes have more #UAC that Vista now, something you made fun of, they aren’t fluid anymore. if you’re listening, doubt it, get your *stuff* together already. I think it has surpassed Apple’s own now. And the obvious part: Screenshot at 22.38.25.png. Simplified file management Synology Drive makes it easy to manage files and folders in your personal space, shared team folders, and items shared with you. No need to download or open files in new tabs. You could use as an alternative some other thing self-hosted, like Nextcloud and leverage the excellent storage backplane your unit does have and, leverage the second-to-none customer support the app has. Quick previewing Preview over 100 different file types, including PDF, ZIP, and PSD, directly in your browser. My biggest issue overall though, is that it constantly disconnects and you had to relink as if it was synced for the first time this could very easily cause corrupt data somewhere. If you do this so it stops bugging then it’d complain of the cert not matching the SLDN or whatever QuickConnnectID represents in the unit. It still keeps pushing to connect instead using QuickConnectID even using a certificate-validated-FQDN in the local network. I was dreaming to get this app before so if I could get rid of the resource-murdering Resilio Sync, but when I first downloaded a beta version of DSM that had it I felt it was exactly the same issues DS Cloud had/has with a plastic-ier look. Synologys intuitive software makes it easy to configure a RAID solution, create volumes, assign user rights, and download office productivity, backup. Install Synology Drive on your Mac using the same steps for Windows OS above. Once Synology Drive is downloaded inside the emulator, locate/click the "All apps" icon to access a page containing all your installed applications including Synology Drive.The search will reveal the Synology Drive app icon.Open the Emulator app you installed » goto its search bar and search "Synology Drive" Access your files anytime and anywhere with Synology Drive app Download Synology Drive for PC and mobile Fast synchronization and reliable backup.On your computer, goto the Downloads folder » click to install Bluestacks.exe or Nox.exe » Accept the License Agreements » Follow the on-screen prompts to complete installation. Your browser and your apps can communicate sensitive information online. Install the emulator on your PC or Mac: doneYou can activate the VPN across your Android, iOS, Windows, and Mac devices.Download Bluestacks Pc or Mac software Here >. We recommend Bluestacks because you can easily find solutions online if you run into problems while using it. Download an Android emulator for PC and Mac:. A key feature of the genre is that characters grow in power and abilities, and characters are typically designed by the player. ![]() Players explore a game world, while solving puzzles and engaging in combat. Players control a central game character, or multiple game characters, usually called a party, and attain victory by completing a series of quests or reaching the conclusion of a central storyline. Role-playing video games use much of the same terminology, settings and game mechanics as early tabletop role-playing games such as Dungeons & Dragons. ![]() RPGs have evolved from simple text-based console-window games into visually rich 3D experiences. The electronic medium removes the necessity for a gamemaster and increases combat resolution speed. Other major similarities with pen-and-paper games include developed story-telling and narrative elements, player character development, complexity, as well as replay value and immersion. ![]() Many role-playing video games have origins in tabletop role-playing games and use much of the same terminology, settings and game mechanics. A role-playing video game, commonly referred to as a role-playing game ( RPG) or computer role-playing game ( CRPG), is a video game genre where the player controls the actions of a character (or several party members) immersed in some well-defined world, usually involving some form of character development by way of recording statistics. ![]() If you’re unsure if you have any trusted devices, don’t be when you set up two-factor authentication, you created trusted devices. If you set up and enabled two-factor authentication - which is different from two-step verification - resetting your password will be even easier, as you’ll be able to reset your password directly from a trusted iPhone, iPad, iPod Touch, or the Apple ID account page. That’s it! If you use two-factor authentication using your iOS device ![]() Step 4: Choose three questions from the drop-down menus, and provide the appropriate answers. Step 3: Enter your password, then click Continue. Step 2: Select I need to reset my security questions and click Continue. After all, only you - or someone who knows you really well - would know the answers to questions like “Who was your favorite teacher?” But what if you forgot the answers to your own security questions? Thankfully, in the event you do, changing them is also a simple process (although you will need access to your password to change them). If you forgot your password, answering security questions is one of the quickest ways to get back into your account to make changes. If you ever forget the answers to your security questions ![]() Going with the security questions requires you to confirm your birthday and answer specific questions before you’re able to create a new password. If you can’t find the email, be sure to check your Spam, Junk, and Trash folders, or repeat the steps above to have the email sent again. You’ll know the email has been sent when you see the Email has been sent page with a large, green checkmark. Step 4: Choosing the email method prompts Apple to send instructions to the primary email address you used to begin this process, or a rescue email if you decided to make one. Which option you choose is based on your personal preference. Step 3: You’ll now be able to choose how you want to reset your password, whether it be through email or by answering a set of security questions. How to turn safe mode on and off on your Android phone The latest iPhone SE just had its price slashed to $149 (seriously) ![]() Should you buy the iPhone 14 or wait for the iPhone 15? Note: If you have two-factor authentication set up for your account, your screen will look different, and you’ll be asked to confirm your phone number (more on that later). Click Continue, then select I need to reset my password. Step 2: You’ll be taken to a page where you enter your Apple ID (in most cases, it’s the primary email address for your Apple account), and then to a new page where you’ll enter your name and the email address associated with the account. Note: Your password may automatically pre-fill the sign-in screen in a drop-down menu, especially if you checked the Remember Me box, so look for it first and click to see if it works Step 1: To start, go to and click Forgot Apple ID or Password in the center of the page. One way to reset your password is by logging onto the Apple ID account page and following these steps. How to reset your password using the Apple ID account page Fortunately, resetting your Apple ID password can be done in several different ways. We’ll show you the ways to do it so you can put this inconvenience aside and move on with your day quickly. |